Skip to main content

Table 2 Primers used in qRT-PCR

From: Transcriptome analysis of Valsa mali reveals its response mechanism to the biocontrol actinomycete Saccharothrix yanglingensis Hhs.015

Gene id Function    Primer  
KUI72642.1 1,3-beta-glucanosyltransferase Fa 5’ CCGAGAAATACATGACCAAGGG 3’
Rb 5’ CAGTGCTAGTTCCAGATCCAG 3’
KUI73737.1 1,3-beta-glucanosyltransferase F 5’ TGACTTCGCCAACCTCAAG 3’
R 5’ TCACCATCGACTAACCATGC 3’
KUI73936.1 Pectinesterase F 5’ ATCGAGGGTGTTACGGATTTC 3’
R 5’ AGAGGACTTGCGACCATTG 3’
KUI65489.1 Chitin deacetylase 1 F 5’ AGAAAGCCCTTATCCGCAAG 3’
R 5’ GCCCATCTCTTTATAGACCTCG 3’
KUI66682.1 Superoxide dismutase F 5’ AGGAAATGTGAAGGGTGCC 3’
R 5’ GTGGATGTGGTAGAGGAAAGG 3’
KUI65198.1 Catalase-1 F 5’ ATGGCTGTTTCCCTAAGTGG 3’
R 5’ GCTCCAATTCACCTACATACCG 3’
KUI64284.1 Citrate synthase F 5’ TTATGGATTACGCCTCAGCTC 3’
R 5’ GGGTAGGGATTCTTGGTCTTG 3’
KUI74469.1 Malate synthase F 5’ GTGAGGGCTGATAAGTTGAGG 3’
R 5’ GCTGATTTGGTGTTGGCATG 3’
KUI72900.1 Isocitrate lyase F 5’ GTGAACCCCGAGACAGAAG 3’
R 5’ TCTTGGACACAATCTGCTCG 3’
KUI64411.1 Beta-glucosidase F 5’ TGGACCTTCACAGATAATTGGG 3’
R 5’ GAAGTCTACCCAAGTTACGCC 3’
KUI66519.1 ABC transporter F 5’ TCACCTATGCAAAGAGATGGG 3’
R 5’ GCCTGCCGAAAATGACATTC 3’
KUI68053.1 Glutathione S-transferase F 5’ TGTGTTGCGGTATCTGAAGG 3’
R 5’ AGCTTCGAACTGGGTGAAAC 3’
KUI70005.1 Sterol 24-C-methyltransferase F 5’ ACATGCTGATCAACTTCCCTG 3’
R 5’ GTACTTCTCAATACCCCATCCG 3’
KUI71751.1 Retinol dehydrogenase F 5’ CAGCGTCAAAGGTCTAGGTG 3’
R 5’ AGGGTTGATGGACTCGATTTC 3’
KUI73928.1 Retinol dehydrogenase F 5’ CTGAAGCTAACCCACCTGATC 3’
R 5’ GTACGAGCAGAGATCCAAGTG 3’
  1. aF: Forward primer
  2. bR: Reversed primer