Skip to main content

Table 3 Primers used in this study

From: Transmating: conjugative transfer of a new broad host range expression vector to various Bacillus species using a single protocol

Primer Name Sequence 5′ – 3′
pUB110_backbone_fw GTCTAAGAAACCATTATTATCATGAC
pUB110_backbone_rv CATAATAGTTATGCAGTTTGTAGAATGC
Fw_pUC_for_Gibson CAAACTGCATAACTATTATGTACGAGCAAAAGGCCAGC
Rv_pUC_from_pBE-S GTCAGGTGGCACTTTTCG
oriT_traJ_fw TCCCCGAAAAGTGCCACCTGACTTAGTGCTTTACGGCACCTCG
oriT_traJ_rv CATGATAATAATGGTTTCTTAGACGCTTCGGGGTCATTATAGCG
sfGFP-fw TAAGCAAAAGGAGAGGGACGCGTATGAGCAAAGGTGAAGAACTG
sfGFP-rv CATTAGTGGTGATGATGGTGATGTCTAGATTTATACAGTTCATCCATACCATG
pBACOV-seq_4894fw CGAGTCTCTACGGAAATAGC
pBACOV-Seq-rv CGATGAGCGCATTGTTAG
QC_g2015t_1 GCGGCGGCGGCAGGCATGAGCCTG
QC_g2015t_2 CAGGCTCATGCCTGCCGCCGCCGC