Skip to main content

Table 1 Primer sequences and PCR conditions for molecular detection of H. pylori

From: Detection and genotyping of Helicobacter pylori in saliva versus stool samples from asymptomatic individuals in Northeastern Thailand reveals intra-host tissue-specific H. pylori subtypes

Genes Primer names: sequences (5′ > 3′) Product size (bp) PCR conditions Ref.
vacA F1/2: GCATGATTTTGGCACCATTG 429 95 °C 30 s, 52 °C 30 s, [21]
R1: TTTTCATATTTAGGGGCAAA 72 °C 45 s (35 cycles)
F1/2: GCATGATTTTGGCACCATTG 276 95 °C 30 s, 62 °C 30 s,
R2: ATCGCATTGCTCAAGCTCAA 72 °C 45 s (35 cycles)
16S rRNA F: CTCATTGCGAAGGCGACCT 139 95 °C 20 s, 58 °C 30 s, [43]
R: TCTAATCCTGTTTGCTCCCCA 72 °C 45 s (35 cycles)