Skip to main content

Table 2 Primers used in this study

From: Isolation and characterization of HepP: a virulence-related Pseudomonas aeruginosa heparinase

Name Sequence Use
hepP-For1 GGACTGGCAAGCTGATAGGA Analysis of hepP transcription
Analysis of operon
hepP-Rev1 CGATACGCAAGGAAAGAGGA Analysis of hepP transcription
Analysis of operon
zbdP-For1 CGGGTGTTGGCTATTGATTT Analysis of zbdP transcription
zbdP-Rev1 AACAATCCGTCCACGCTTAC Analysis of zbdP transcription
zbdP-For2 CTTCTGAGGACAAGGCTTCG Analysis of operon
hepP-Rev2 GATAAGGCTCCCAACCTTC Analysis of operon
zbdP-For3 AGCCGACTATCGCTTGTGAA Confirmation of hepP mutation
hepP-Rev3 GTGCTTTTCGAGCAATGGAG Confirmation of hepP mutation
hepP-ATG ATGGCACTTCAAAAACTCGTCCG Cloning hepP
hepP-[-TGA] ACTCGTATTTGCTGGGGTGGAATT Cloning hepP
Trx Forward TTCCTCGACGCTAACCTG Confirmation of cloning
pBAD Reverse GATTTAATCTGTATCAGG Confirmation of cloning
hepP-For2 CGCTGGTGCAACAAGTAGAA Analysis of hepP transcription
hepP-Rev4 GCGTGATACATCGGAGACAA Analysis of hepP transcription
  1. Primers were purchased from Integrated DNA Technologies