Skip to main content

Table 2 Primers designed in this study

From: The distinctive cell division interactome of Neisseria gonorrhoeae

Primer name Sequences (5′-3′)
P1 FtsA-reBamHI GCGCGGATCCTCAGAGGTTGTTTTCAATCC
P2 FtsA-fwSalI GCGCGTCGACCATGGAACAGCAGAAAAGATAC
P3 fwSalI-ftsK GCGCGTCGACCATGTTTTGGATAGTTTTGATCGTTAT
P4 reBamHI-ftsK CGCGGGATCCTCAAGCATTGTCCAAGGGGACGAG
P5 fwSalI-ftsQ GCGCGTCGACCATGTGGGATAATGCCGAAGCGATG
P6 reBamHI-ftsQ CGCGGGATCCCTATTCTTCGGATTCTTTTTCGGG
P7 fwSalI-ftsI GCGCGTCGACCATGTTGATTAAAAGCGAATATAAGCC
P8 reBamHI-ftsI CGCGGGATCCTTAAGACGGTGTTTTGACGGCTGC
P9 fwSalI-ftsW GCGCGTCGACCATGAAGATTTCGGAAGTATTGGTAAA
P10 reBamHI-ftsW CGCGGGATCCTTACTCCACCCGGTAACCGCGCAT
P11 fwSalI-ftsN GCGCGTCGACCATGTTTATGAACAAATTTTCCCAATC
P12 reBamHI-ftsN CGCGGGATCCTTATTTGCCTTCAATCGCACGGAT
P13 fwBglII-ZipA GCGCGAGATCTGATGATTTACATCGTACTGTTCCTC
P14 reBamHI-ZipA CGCGGGATCCTTATGAAAACAGGCGCAGGGC
P15 FtsA-reEcoRI-pET30a ATATCGAATTCTCAGAGGTTGTTTTCAATCCACC
P16 FtsA-fwBglII-pET30a AGCCCAGATCTGATGGAACAGCAGAAAAGATACATC
P17 fwBglII-FtsQ- pET30a AGCCCAGATCTGATGTGGGATAATGCCGAAGCGATG
P18 reEcoRI-ftsQ- pET30a ATATCGAATTCCTATTCTTCGGATTCTTTTTCGGG
P19 FtsZ-fwBgl II-pET30a AGCCCAGATCTGATGGAATTTGTTTACGACGTGGCA
P20 FtsZ-ReEcoRI-pET30a AGCCCGAATTCTTATTTGTCTGAATTGTGTTGACG
P21 fwFtsA-BamHI-GST CGCGGGATCCATGGAACAGCAGAAAAGATACATC
P22 fwEcoRI-FtsN GACGAATTCATGTTTATGAACAAATTTTCCCAATCC
P23 reXhoI-FtsN GACCTCGAGTTATTTGCCTTCAATCGCACG