Skip to main content

Advertisement

Table 2 Sequences of oligonucleotides used for relative quantification in real-time PCR

From: Strain-dependent interactions of Streptococcus gallolyticus subsp. gallolyticus with human blood cells

Gene name Forward primer (5′ to 3′) Reverse primer (5′ to 3′)
Interleukin-1β (IL1B), ACAGATGAAGTGCTCCTTCCA
GTCGGAGATTCGTAGCTGGAT
Interleukin-6 (IL6) ACAGCCACTCACCTCTTCAG
GTGCCTCTTTGCTGCTTTCAC
Interleukin-8 (IL8) GAACTGAGAGTGATTGAGAGTGGA
CTCTTCAAAAACTTCTCCACAACC
Hypoxanthine phosphoribosyltransferase 1 (HPRT) GCTGACCTGCTGGATTAC
TGCGACCTTGACCATCTT
Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) AGGTCGGAGTCAACGGAT
TCCTGGAAGATGGTGATG