Skip to main content

Table 1 PCR protocol for specific Kingella kingae multilocus sequence typing

From: A modified multilocus sequence typing protocol to genotype Kingella kingae from oropharyngeal swabs without bacterial isolation

Primer design
Gene Primers name Primers Primer length (bp) Amplicon length (bp)
abcZ abcZ_Kki_Fwd CGCAAGAAAGCGTGTTTGAC 20 532
abcZ_Kki_Rev CAATTCCTGCGCCTTTTTCTC 21
adk adk_Kki_Fwd CACACAAGCGCAATTTATTACG 22 491
adk_Kki_Rev AAACTTCGGTTTGTTCGTGATAT 23
aroE aroE_Kki_Fwd CAAATCCCCACAAATTCATCAATG 24 621
aroE_Kki_Rev AACGCGGTGGGCTGGTTC 18
cpn60 cpn60_Kki_Fwd CATGGGCGCACAAATGGTT 19 467
cpn60_Kki_Rev CAAACAACAACACAAATGGGC 21
recA recA_Kki_Fwd GACGGCAGCCACCAAGAC 21 456
recA_Kki_Rev TCCTGCCAGTTTACGCAAG 19
gdh/zwf gdh/zwf_Kki_Fwd GAGCGCGGCGAGTTTTAT 18 671
gdh/ zwf_Kki_Rev CAGTTGTCCAAAATTGGCATG 21
 10× PCR Buffer    
 25 mM MgCl2   2.0 mM   
 dNTP mix (10  mM of each)   200 μM of each dNTP   
 Forward primer   0,1 μM   
 Reverse primer   0,1 μM   
 HotStarTaq DNA Polymerase   2.5 units/ reaction   
 Distilled water   variable   
 Template DNA   < 0,5 μg   
 Total volume   50 μl   
PCR protocol
 Cycle step 3 step-protocol Cycles
Temperature Time
 Initial denaturation 95 °C 15 min 1
 Denaturation 95 °C 1 min 35
 Annealing 58 °C 30 s
 Elongation 72 °C 1 min 30 s
 Final elongation 72 °C 10 min 1