Skip to main content

Table 1 Primer sequence information for all platforms

From: A comparison of sequencing platforms and bioinformatics pipelines for compositional analysis of the gut microbiome

Platform Primer Name Sequence (5′ -3′) Targeting Region
Roche 454 Roche Titanium Fusion Primer A CCATCTCATCCCTGCGTGTCTCCGACTCAG V1-V2
Universal Bacterial Primer 8F AGAGTTTGATCCTGGCTCAG V1-V2
Roche Titanium Primer B CCTATCCCCTGTGTGCCTTGGCAGTCTCAG V1-V2
Reverse Bacterial Primer 338R GCTGCCTCCCGTAGGAGT V1-V2
Illumina MiSeq Forward Primer TCGTCGGCAGCGTCAGATGTGTATAAGAGACAGAGAGTTTGATCCTGGCTCAG V1-V2
Reverse Primer GTCTCGTGGGCTCGGAGATGTGTATAAGAGACAGGCTGCCTCCCGTAGGAGT V1-V2
Ion Torrent PGM Forward Primer composed of Ion Torrent adapter A CCATCTCATCCCTGCGTGTCTCCGACTCAG V1-V2
Universal Bacterial Primer 8F AGAGTTTGATCCTGGCTCAG V1-V2
Reverse Primer of Ion Torrent trP1 adapter CCTCTCTATGGGCAGTCGGTGAT V1-V2
Reverse Bacterial Primer 338R GCTGCCTCCCGTAGGAGT V1-V2