Skip to main content

Table 2 Primers used for qRT-PCR

From: Growth phase-dependent expression profiles of three vital H-NS family proteins encoded on the chromosome of Pseudomonas putida KT2440 and on the pCAR1 plasmid

Name Sequences (5′→3′) References
univ16S-F ACACGGTCCAGACTCCTACG 17
univ16S-R TACTGCCCTTCCTCCCAACT 17
PP_1366-F AACTGGAGTTCGAAGGCAAA 13
PP_1366-R GAGGTGCCTTGCTCAGTTTC 13
PP_3765-F ATATCATCGCCATCCTCGAC 13
PP_3765-R TGCGGGTTCTGATAGACCTT 13
pmr-F-2 TCGCGATTCTTGATCCGGAC This study
pmr-R-2 CCTTGGTCTCAACGAGCTCA This study