Skip to main content

Table 1 Sequences of the primers used for phylogenetic and virulence potential analysis

From: Genetic diversity and virulence potential of clinical and environmental Aeromonas spp. isolates from a diarrhea outbreak

Gene Sequence (5′-3′) Reference
PCR
 16S rRNAF AGAGTTTGATCATGGCTCAG Borrell et al. [19]
 16S rRNAR GGTTACCTTGTTACGACTT Borrell et al. [19]
gyrB 3F TCCGGCGGTCTGCACGGCGT Yáñez et al. [20]
gyrB 14R TTGTCCGGGTTGTACTCGTC Yáñez et al. [20]
hlyAF GGCCGGTGGCCCGAAGATACGGG Heuzenroeder et al. [21]
hlyAR GGCGGCGCCGGACGAGACGGG Heuzenroeder et al. [21]
altF CCATCCCCAGCCTTTACGCCAT Martínez et al. [22]
altR TTTCACCGAGGTGACGCCGT Martínez et al. [22]
astF ATGCACGCACGTACCGCCAT Martínez et al. [22]
astR ATCCGGTCGTCGCTCTTGGT Martínez et al. [22]
Sequencing
 16S BF AGCAGTGGGGAATATTGCAC This study
 16S BR GGCAACAAAGGACAGGGGT This study
 16S CF ACGCAGGCGGTTGGATAAGT This study
 16S CR AAATCGACATCGTTTACGGCG This study
 16S DF AACCTTACCTGGCCTTGACA This study
 16S DR CACACACGCGGCATGGTGCATC This study
 gyrB 9Rs CCTTGACCGAAATGACCGCC Yáñez et al. [20]
gyrB 7F GGGGTCTACTGCTTCACCAA Yáñez et al. [20]
gyrB 9R ACCTTGACGGAGATAACGGC Yáñez et al. [20]