Skip to main content

Table 1 List of primers

From: Simultaneous detection of chikungunya virus, dengue virus and human pathogenic Leptospira genomes using a multiplex TaqMan® assay

Name Fluorochrome Sequence (5′➔ 3′) Quencher Nt Tm (°C) Target
CHIK-F   AAGCTYCGCGTCCTTTACCAAG   22 62.1–64.2 E1
CHIK-R   CCAAATTGTCCYGGTCTTCTT   21 57.5–59.5
CHIK-P FAM CCAATGTCYTCMGCCTGGACACCTTT BHQ1 26 67.9–71.1
DF   AGGACTAGAGGTTAGAGGAGA   21 59.5  
DRa   CGTTCTGTGCCTGGAATGAT   20 58.4  
DRb   CGCTCTGTGCCTGGATTGAT   20 60.5  
DP HEX CCA + GA + GAT + CCT + GCT BHQ1 14 43.7 + LNA = 67 3′NC
Lep23S-F   AGAATTGGGATGAGGTGTGGATAG   24 63.6  
Lep23S-R   CTACCCCCGCAACTAAACAACTG   23 64.6  
Lep23S-P ATTO647N CCG + AAA + TAG + GTT + TA + GG + CCT BHQ3 19 55 + LNA = 72 23S rRNA
  1. Variable melting temperature was indicated for degenerate primers. Y accounts for C/T, M for A/C. Probes are quenched using adequate Black Hole Quenchers (BHQ). Locked Nucleic Acid nucleotides (LNA) are prefixed with a “+” sign and the resulted increase in Tm was indicated following use of Exiqon™ tool for calculation