Skip to main content

Table 1 Oligonucleotide sequence for the amplification of mecA, orfX and SCCmec types

From: In vitro transfer of methicillin resistance determinants mecA from methicillin resistant Staphylococcus aureus (MRSA) to methicillin susceptible Staphylococcus aureus (MSSA)

S/N Primer Oligonucleotide sequence 5’to 3′ Product size Annealing temperature Reference
1 mecAF mecAR ACTGCTATCCACCCTCAAAC 163 bp 57 °C/120 s Noto. [27]; Mehrotra et al. [28]
CTGGTGAAGTTGTAATCTG
2 Nuc-F GCG ATT GAT GG TGA TAC GGT T 276 bp 55 °C/120 s Saiful et al. [29]
Nuc-R AGC CAA CGG TTG ACG AAC TAA AGC
3 OrfX F GAG AAA TAT TGG AAG CAA GCC 326 bp 54.6 °C/60s Noto. [27]
OrfX R CGC ATA ATC TTA AAT GCT CTG
4 SCCmecIIIFSCCmecIIIR TTC TCA TTG ATG CTG AAG CC 280 bp 55 °C /60 s Zhang et al. [30]
GTG TAA TTT CTT TTG AAA GAT ATG G
5 mecA F 5′-ACTGCTATCCACCCTCAAAC-3′ 533 bp 55 °C/120 s Saiful et al. [29]
mecA R 5′-CTGGTGAAGTTGTAATCTGG-3′