Skip to main content

Table 5 Plasmids

From: Polynucleotide phosphorylase is implicated in homologous recombination and DNA repair in Escherichia coli

Plasmid Relevant characters Reference
pAZ101 pGZ119HE derivative, harbours the pnp + allele [58]
pAZ1112 pAZ101 derivative; harbours the pnp-S438A allele encoding a catalytically inactive PNPase [24]
pAZ1113 pAZ101 derivative; harbours the pnp-74 allele (ΔKH 603–615) under the control of pnp P2 promoter. Obtained by cloning the AgeI-BsiWI fragment of pnp-74 from pEJ04 in the large AgeI-BsiWI fragment of pAZ101. this work
pAZ1114 pAZ101 derivative; harbours the pnp-78 allele (ΔS1 622–633) under the control of pnp-p2 promoter. Obtained by cloning the AgeI-BsiWI fragment of pnp-78 from pEJ08 in the large AgeI-BsiWI fragment of pAZ101. this work
pAZ1115 pGZ119HE derivative; harbours the rnb + allele under the control of its own rnb-p promoter. Obtained by cloning into pGZ119HE a BamHI-HindIII-digested PCR fragment amplified from MG1655 DNA with primers FG3063 (CGGGATCCTGCAAGGGCGAAAATG) and FG3086 (CCCAAGCTTCATGAAATTAACGGCGGC) encompassing chromosomal coordinates 1,349,209-1,344,800 (NCBI Sequence ID U00096.3). this work
pAZ133 pAZ101 derivative, harbours the Δpnp-833 allele encoding Pnp-ΔKHS1 [23]
pEJ04 Harbours the pnp-74 allele under T5 promoter-lacO operator control [22]
pEJ08 Harbours the pnp-78 allele under T5 promoter-lacO operator control [22]
pGZ119HE ColD, CamR [50]