Skip to main content

Table 1 Primers of all carbapenems resistance genes studied and PCR annealing temperature

From: Clonality, outer-membrane proteins profile and efflux pump in KPC- producing Enterobacter sp. in Brazil

Primers Sequences (5′-3′) Annealing temperature Size (pb)
blaTEM - F TCGCCGCATACACTATTCTCAGAATGA 55 420
blaTEM - R ACG CTC ACC GGC TCC AGA TTT AT
blaCTXM - F GCT CTAGAATTATTGCATCAGAAA CCGTG 55 893
blaCTXM - R CGGAATTCATGATGACTCAGAGCATTGG
bla OSHV - F TGCTTTGTTAATTCGGGCCAA 55 730
bla SHV - R ATGCGTTATATTCGCCTGTG
bla OXA48 - F GTAACAATGCTTGGTTCG 55 177
bla OXA48 - R TGTTTTTGGTGGCATCGA
blakpc - F GTTACGCCAAAGGACGAAC   893
blakpc - R TTTTCAGAGCCTTACTGCCC
bla SPM -F CCTTTTCCGCGACCTTGATC 59 798
bla SPM - R ATGCGCTTCATTCACGCAC
bla SIM - F GTACAAGGGATTCGGCATCG 58 569
bla SIM - R GTACAAGGGATTCGGCATCG
bla IMP -F TTGGAAAATTATATAATCCC 47 188
bla IMP - R CCAAACCACTAGGTTATC
bla VIM - F TTTGGTCGCATATCGCAAAG 60 382
bla VIM- R CCATTCAGCCCAGATCGGCAT
bla NDM - F GGCGGAATGGCTCATCACGA 60 375
bla NDM - R CGCAACACAGCCTGACTTTC
AcrART - F GAT TAT GAT TCT GCC TTG GCCG 60 130
AcrART - R CAA TGC GAC CGC TGA TAG GGG