Skip to main content

Advertisement

Table 2 Enterococcus virulence genes and PCR primers which were used in this study

From: Comparison of pathogenic and non-pathogenic Enterococcus cecorum strains from different animal species

Virulence factor Gene Localisation Primer name Oligonucleotide sequence (5’ to 3’) Product size Primer source
Cytolysin cylA Chromosome/Plasmide CYT I
CYT IIb
ACTCGGGGATTGATAGGC
GCTGCTAAAGCTGCGCTT
688 Vankerckhoven et al., 2004 [40]
Enterococcal surface protein esp Chromosome ESP 14 F
ESP 12R
AGATTTCATCTTTGATTCTTGG
AATTGATTCTTTAGCATCTGG
510 Vankerckhoven et al., 2004 [40]
Hyaluronidase hyl Chromosome HYL n1
HYL n2
ACAGAAGAGCTGCAGGAAATG
GACTGACGTCCAAGTTTCCAA
276 Vankerckhoven et al., 2004 [40]
Aggregation substance asa1 Plasmide ASA 11
ASA 12
GCACGCTATTACGAACTATGA
TAAGAAAGAACATCACCACGA
375 Vankerckhoven et al., 2004 [40]
Gelatinase gelE Chromosome GEL11
GEL12
TATGACAATGCTTTTTGGGAT
AGATGCACCCGAAATAATATA
213 Vankerckhoven et al., 2004 [40]
Cell wall adhesin of E. faecium efaAfm Chromosome TE37
TE38
AACAGATCCGCATGAATA
CATTTCATCATCTGATAGTA
735 Reviriego et al., 2005 [41]
Cell wall adhesin of E. faecalis efaAfs Chromosome TE5
TE6
GACAGACCCTCACGAATA
AGTTCATCATGCTGTAGTA
705 Reviriego et al., 2005 [41]
Sex pheromone ccf Chromosome TE53
TE54
GGGAATTGAGTAGTGAAGAAG
AGCCGCTAAAATCGGTAAAAT
543 Reviriego et al., 2005 [41]