Comparison of pathogenic and non-pathogenic Enterococcus cecorum strains from different animal species

BMC Microbiology

Table 2 Enterococcus virulence genes and PCR primers which were used in this study

Virulence factor	Gene	Localisation	Primer name	Oligonucleotide sequence (5’ to 3’)	Product size	Primer source
Cytolysin	cylA	Chromosome/Plasmide	CYT I CYT IIb	ACTCGGGGATTGATAGGC GCTGCTAAAGCTGCGCTT	688	Vankerckhoven et al., 2004 [40]
Enterococcal surface protein	esp	Chromosome	ESP 14 F ESP 12R	AGATTTCATCTTTGATTCTTGG AATTGATTCTTTAGCATCTGG	510	Vankerckhoven et al., 2004 [40]
Hyaluronidase	hyl	Chromosome	HYL n1 HYL n2	ACAGAAGAGCTGCAGGAAATG GACTGACGTCCAAGTTTCCAA	276	Vankerckhoven et al., 2004 [40]
Aggregation substance	asa1	Plasmide	ASA 11 ASA 12	GCACGCTATTACGAACTATGA TAAGAAAGAACATCACCACGA	375	Vankerckhoven et al., 2004 [40]
Gelatinase	gelE	Chromosome	GEL11 GEL12	TATGACAATGCTTTTTGGGAT AGATGCACCCGAAATAATATA	213	Vankerckhoven et al., 2004 [40]
Cell wall adhesin of E. faecium	efaAfm	Chromosome	TE37 TE38	AACAGATCCGCATGAATA CATTTCATCATCTGATAGTA	735	Reviriego et al., 2005 [41]
Cell wall adhesin of E. faecalis	efaAfs	Chromosome	TE5 TE6	GACAGACCCTCACGAATA AGTTCATCATGCTGTAGTA	705	Reviriego et al., 2005 [41]
Sex pheromone	ccf	Chromosome	TE53 TE54	GGGAATTGAGTAGTGAAGAAG AGCCGCTAAAATCGGTAAAAT	543	Reviriego et al., 2005 [41]

ISSN: 1471-2180