Skip to main content

Advertisement

Table 2 Enterococcus virulence genes and PCR primers which were used in this study

From: Comparison of pathogenic and non-pathogenic Enterococcus cecorum strains from different animal species

Virulence factor Gene Localisation Primer name Oligonucleotide sequence (5’ to 3’) Product size Primer source
Cytolysin cylA Chromosome/Plasmide CYT I CYT IIb ACTCGGGGATTGATAGGC GCTGCTAAAGCTGCGCTT 688 Vankerckhoven et al., 2004 [40]
Enterococcal surface protein esp Chromosome ESP 14 F ESP 12R AGATTTCATCTTTGATTCTTGG AATTGATTCTTTAGCATCTGG 510 Vankerckhoven et al., 2004 [40]
Hyaluronidase hyl Chromosome HYL n1 HYL n2 ACAGAAGAGCTGCAGGAAATG GACTGACGTCCAAGTTTCCAA 276 Vankerckhoven et al., 2004 [40]
Aggregation substance asa1 Plasmide ASA 11 ASA 12 GCACGCTATTACGAACTATGA TAAGAAAGAACATCACCACGA 375 Vankerckhoven et al., 2004 [40]
Gelatinase gelE Chromosome GEL11 GEL12 TATGACAATGCTTTTTGGGAT AGATGCACCCGAAATAATATA 213 Vankerckhoven et al., 2004 [40]
Cell wall adhesin of E. faecium efaAfm Chromosome TE37 TE38 AACAGATCCGCATGAATA CATTTCATCATCTGATAGTA 735 Reviriego et al., 2005 [41]
Cell wall adhesin of E. faecalis efaAfs Chromosome TE5 TE6 GACAGACCCTCACGAATA AGTTCATCATGCTGTAGTA 705 Reviriego et al., 2005 [41]
Sex pheromone ccf Chromosome TE53 TE54 GGGAATTGAGTAGTGAAGAAG AGCCGCTAAAATCGGTAAAAT 543 Reviriego et al., 2005 [41]