Skip to main content

Table 1 Genes, oligonucleotide primers and PCR conditions used in this study

From: Methicillin resistance and virulence genes in invasive and nasal Staphylococcus epidermidis isolates from neonates

Protein or genetic element Gene Primers 5’ → 3’a Amplicon size
(bpb)
PCR
conditions
References
Aae aae F: GAGGAGGATTTTAAAGTGC
R: AACATGACCATAGTAACC
858 94 °C, 3 min; 40 cycles of: 94 °C, 90s; 55 °C, 1 min; 72 °C, 90s; final extension 72 °C, 5 min. [8]
Aap aap F: ATACAACTGGTGCAGATGGTTG
R: GTAGCCGTCCAAGTTTTACCAG
400 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min. [52]
AtlE atlE F: CAACTGCTCAACCGAGAACA
R: TTTGTAGATGTTGTGCCCCA
682 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 62 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min. [33]
Bhp bhp F: ACGGACAATATCGTCTCTCAA
R:: AACTTCAGCCGTTCCCTT
1917 94 °C, 2 min; 40 cycles of: 94 °C, 30s; 55 °C, 30s; 72 °C, 75 s; final extension 72 °C, 5 min. [10]
Embp embp F: AGCGGTACAAATGTCAATATC
R: AGAAGTGCTCTAGCATCATCC
455 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 62 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min. [6]
GehD gehD F: TTTGAATTCTGCGCAAGCTCAATATAA
R: TTTGCGGCCGCTATCGCTACTTACGTGTAA
1179 94 °C, 2 min; 30 cycles of: 94 °C, 30s; 55 °C, 30s; 72 °C, 75 s; final extension 72 °C, 5 min. [9]
SdrF sdrF F: GCTGAAGACAATCAATTAG
R: TTAATATCCCCCTGTGCTG
1875 94 °C, 4 min; 30 cycles of: 94 °C, 2 min; 60 °C, 1 min; 72 °C, 2 min; final extension 72 °C, 5 min. [10]
SdrG fbe F: TAAACACCGACGATAATAACCAAA
R: GGTCTAGCCTTATTTTCATATTCA
496 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 62 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min. [5]
SesI sesI F: GCTGATTATGTAAATGACTCAAAT
R: AGCTTTTGTTGTTTGAGCTTC
408 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 50 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min. [11]
IcaADB icaADB F: TTATCAATG CCGCAGTTGTC
R: GTTTAACGCGAGTGCGCTAT
546 94 °C, 3 min; 30 cycles of: 94 °C, 1 min; 58 °C, 1 min; 72 °C, 1 min; final extension 72 °C, 5 min. [33]
ACME arcA F: CTAACACTGAACCCCAATG
R: GAGCCAGAAGTACGCGAG
1946 95 °C, 10 min; 30 cycles of: 94 °C, 1 min; 52 °C, 1 min; 72 °C, 2 min; final extension 72 °C, 5 min. [43]
opp3AB F: GCAAATCTGTAAATGGTCTGTTC
R: GAAGATTGGCAGCACAAAGTG
1183
  1. a F: Forward; R: Reverse
  2. b bp: base pairs