Skip to main content

Table 2 Primer sequences for antibiotic resistance genes

From: Interspecies transfer of vancomycin, erythromycin and tetracycline resistance among Enterococcus species recovered from agrarian sources

List of primers used
Gene Primer Sequence 5′ to 3′ Product Size References
tetK tetK F TTAGGTGAAGGGTTAGGTCC 718 [31]
tetK R GCAAACTCATTCCAGAAGCA   
tetL tetL F ATAAATTGTTTCGGGTCGGTAAT 1077 [32]
tetL R AACCAGCCAACTAATGACAATGAT  
tetM tetM F GTTAAATAGTGTTCTTGGAG 657 [31]
tetM R CTAAGATATGGCTCTAACAA   
tetO tetO F GATGGCATACAGGCACAGAC 614 [33]
tetO R CAATATCACCAGAGCAGGCT   
tetS tetS F TGGAACGCCAGAGAGGTATT 660 [33]
tetS R ACATAGACAAGCCGTTGACC   
tetT tetT F AAGGTTTATTATATAAAAGTG 169 [34]
tetT R AGGTGTATCTATGATATTTAC   
tetW tetW F GAGAGCCTGCTATATGCCAGC 168 [33]
tetW R GGGCGTATCCACAATGTTAAC   
ErmB ermB F AGGGTTGCTCTTGCACACTC 119 This study1
ermB R CTGTGGTATGGCGGGTAAGT   
VanA vanA F CTACTCCCGCCTTTTGGGTT 109 This study2
vanA R TTCACACCGAAGGATGAGCC   
  1. 1: >gi|488766672:c26630-25893, 2:>gi|305678685:28460–29491