Skip to main content

Table 1 Primers used in this study

From: Improving the production of acetyl-CoA-derived chemicals in Escherichia coli BL21(DE3) through iclR and arcA deletion

Primer name Sequence
Strain construction
 ID-iclR_F TACGAAATGCCGGATCGTTG
 ID-iclR_R TCTTGTTTATCAAGAGTGTC
 pKD13-Kan_R GGTGAGATGACAGGAGATCC
RT-PCR Reaction
 16S rRNA_F TGGTCTGAGAGGATGACCAG
 16S rRNA_R TGCTTCTTCTGCGGGTAACG
aceB_F ATGACTGAACAGGCAACAAC
aceB_R CGAATGGAAGCT GTTTCCGA
aceA_F ATGAAAACCCGTACACAACA
aceA_R CGAGGCTGTTGATGTAGCCT
aceK_F CGTGGCCTGGAATTATTGAT
aceK_R GTTAGTAATGCAGCGCAGTT