Skip to main content

Table 1 Primers used in this study

From: Burkholderia pseudomallei-derived miR-3473 enhances NF-κB via targeting TRAF3 and is associated with different inflammatory responses compared to Burkholderia thailandensis in murine macrophages

Target gene Sequence Length (nt) Note
TNF-F CCCCTCAGCAAACCACCAAG 20  
TNF-R CTTGGCAGATTGACCTCAGC 20  
TRAF3-F GAGCAAGGAGGCTACAAGGAG 21 [32]
TRAF3-R CATGCAGCTCTCGCAGAAC 19
Actin-F TGGCACCCAGCACAATGAA 19 [32]
Actin-R CTAAGTCATAGTCCGCCTAGAAGCA 25
P- TRAF3-overexpress -F ATGGAGTCAAGCAAAAAGATGGA 23  
P- TRAF3-overexpress -R GGGGTCAGGCAGATCCGA 18
miR-3473-TRAF3-F CTAGTGGTTCTAGAAAGTGTCAGTTTAACCAGA
TCTCTCTCCACCACCAGAACTTTGTCTCTGCCA
60 Sangon
miR-3473-TRAF3-R AGCTTGGCAGAGACAAAGTTCTGGTGGTGGAG
AGAGATCTGGTTAAACTGACACTTTCTAGAACCA
miR-3473-TRAF3-mut-F CTAGTGGTTCTAGAAAGTGTCAGTTTAACCAGA
TCTGTTTGCACCACCAGAACTTTGTCTCTGCCA
60
miR-3473-TRAF3-mut -R AGCTTGGCAGAGACAAAGTTCTGGTGGTGCAA
ACAGATCTGGTTAAACTGACACTTTCTAGAACCA