Skip to main content

Table 1 List of oligonucleotides

From: Small proteins in cyanobacteria provide a paradigm for the functional analysis of the bacterial micro-proteome

Name of Oligonucleotide Sequence (in 5′ – 3′ direction) Application
Probe_norf1_fw GTAATACGACTCACTATAGGGAGACCATCGACTATTCTTCAGTACTGTTTAC Amplification of probe template norf1 (168 nt) for in vitro-transcription (T7 promoter is underlined)
Probe_norf1_rev TTGAGATGCTACAGGACCTTATGC
Pnorf1_fw taccggtGCCTAGGGGATACCTCTCCCC Amplification of putative norf1 promoter for ligation into pILA reporter plasmid
Pnorf1_rev tggccggcCTCCGTCCCAATGGGGGAAAC
nsiR6_probe_fw GTAATACGACTCACTATAGGGAGATTACCGATCGCCGCTTCATC Amplification of probe template nsiR6 (166 nt) for in vitro-transcription (T7 promoter is underlined)
nsiR6_probe_rev TGTGTGGCGTCACCATTGAAAATG
hliR1_probe_fw GTAATACGACTCACTATAGGGAGACTCGGGAAGATTAAGACTGGTTTTG Amplification of probe template hliR1 (135 nt) for in vitro-transcription (T7 promoter is underlined)
hliR1_probe_rev ATGTCTAATTTGATTGCTGTTGCTTTC
norf4_probe_fw GTAATACGACTCACTATAGGGAGACCCCCTTTAGCAAAACTACCCATC Amplification of probe template norf4 (116 nt) for in vitro-transcription (T7 promoter is underlined)
norf4_probe_rev ATGACCGCCGATCAACTGTTG
nsiR6_fw gccaagaagtATGAGTGTTTTCCCCGCAGA Amplification of nsiR6 generating overlaps with PpetE and 3xFLAG::3′UTR norf1::Toop
nsiR6_rev tataatccatGTCGTAATAATCCCGGCTGG
PpetE::hliR1_fw gccaagaagtATGTCTAATTTGATTGCTGTTG Amplification of hliR1 generating overlaps with PpetE and 3xFLAG::3′UTR norf1::Toop
3xFlag_hliR1_rev tataatccatCTCGGGAAGATTAAGACTGG
PpetE::ssr1169_fw gccaagaagtATGGATATTGTTAAGATCATTTGTGCGATTC Amplification of ssr1169 generating overlaps with PpetE and 3xFLAG::3′UTR norf1::Toop
3xFlag_ssr1169_rev tataatccatACGTTCCCTGGCAATGACCC
PpetE::Norf4_fw gccaagaagtATGACCGCCGATCAACTGTT Amplification of n orf4 generating overlaps with PpetE and 3xFLAG::3′UTR n orf1::Toop
3xFlag_Norf4_rev tataatccatACCCCCTTTAGCAAAACTAC
pUC19-XbaI_PpetE_fw gctcggtacccggggatcctctagaCTGGGCCTACTGGGCTATTC Amplification of PpetE introducing XbaI site (underlined) + creating overlaps with pUC19 and nsiR1, hliR 1, ssr1169 or n orf4
nsiR6::PpetE_rev aaacactcatACTTCTTGGCGATTGTATCTATAGG
hliR1::PpetE_rev aattagacatACTTCTTGGCGATTGTATCTATAGG
ssr1169::PpetE_rev caatatccatACTTCTTGGCGATTGTATCTATAGG
Norf4::PpetE_rev gatcggcggtcatACTTCTTGGCGATTGTATCTATAGG
3xFlag_PstI-pUC19_rev gccaagcttgcatgcctgcagAATAAAAAACGCCCGGCGGC Amplification of 3xFLAG::3′UTR norf1::Toop introducing PstI site (underlined) + creating overlaps with pUC19 and nsiR1, hlirR, ssr1169 or norf4 or amplification of particular CDS associated with 3xFLAG__3′UTR norf1::Toop introducing PstI site (underlined) + creating overlaps with pUC19 and respective promoter sequence
nsiR6_3xFlag_fw ttattacgacATGGATTATAAAGATCATGATGGCGATTATAAAG
hliR1_3xFlag_fw tcttcccgagATGGATTATAAAGATCATGATGGCGATTATAAAG
ssr1169_3xFlag_fw cagggaacgtATGGATTATAAAGATCATGATGGCGATTATAAAG
Norf4_3xFlag_fw taaagggggtATGGATTATAAAGATCATGATGGCGATTATAAAG
CDSnsiR6::PnsiR6_fw ataaatactcATGAGTGTTTTCCCCGCAGAAAC
CDShliR1::PhliR1_fw aaattaactaaATGTCTAATTTGATTGCTGTTGCTTTCTG
CDSNorf4::PNorf4_fw aatttttaccATGACCGCCGATCAACTGTTG
CDSssr1169::Pssr1169_fw gagtgaactaATGGATATTGTTAAGATCATTTGTGCGATTC
pUC19::PnsiR6_fw gctcggtacccggggatcctctagaATCGCCGTATTACACCTCTG Amplification of PnsiR6 introducing XbaI site (underlined) + generating overlaps with pUC19 and nsiR6.
PnsiR6::CDSnsiR6_rev aaacactcatGAGTATTTATTCCTAGTGAATGAATTAGAAG
pUC19::PhliR1_fw gctcggtacccggggatcctctagaGGAGTTTACAGCGAGATTTG Amplification of PhliR1 introducing XbaI site (underlined) + generating overlaps with pUC19 and hliR1.
PhliR::CDShliR1_rev aattagacatTTAGTTAATTTTTGTAACGGGAG
pUC19::PNorf4_fw gctcggtacccggggatcctctagaAGGTGATGATTATGAGCCGTC Amplification of Pnorf4 introducing XbaI site (underlined) + generating overlaps with pUC19 and norf4.
PNorf4::CDSNorf4_rev gatcggcggtcatGGTAAAAATTCCACTAATTCAAAAAAC
pUC19::Pssr1169_fw gctcggtacccggggatcctctagaCGAGTAGCCAGCCAAAGCAG Amplification of Pssr1169 introducing XbaI site (underlined) + generating overlaps with pUC19 and ssr1169.
Pssr1169::CDSssr1169_rev caatatccatTAGTTCACTCCAATATGTCGGGATAATTAG