Skip to main content

Table 1 Synthetic oligonucleotides

From: Inactivation of MSMEG_0412 gene drastically affects surface related properties of Mycobacterium smegmatis

Name Sequence (5′ - 3′)a Position of Annealingb
0412-S CATGATCCCCGAGGAGCAC +857/+875
0412-A TTGCCGTTCAAGTACCTCGG +889/+90
0412-Fw AAAGCTAGCATGAGGAGACGACTTCTCGCGTTC +1/+24
0412-spFw AAAGCTAGCGATGACACCAAACCGGTCG +85/+103
0412-Rv AAAGCTAGCTCAGGGCTTGGGCGCCGGTTG +1132/+1152
0412-gfpRv AAAGCTAGCGGGCTTGGGCGCCGGTTG +1132/+1149
0412-1F CTAGAAGCTTGCACCGCACTGGTGAGATA -690/-672
0412-1R CTAGGGTACCCGCTGTAGTCCTCTGCT -5/+12
0412-2F CTAGGGTACCGGACTGCAGTACGTCGTGAACA +1108/+1129
0412-2R CTAGGGTACCACCATGTGGATCCCTCTCCT +1818/+1837
  1. aUnderlined is an unpaired tail carrying a restriction site
  2. bPosition of annealing refers to msmeg_0412 gene sequence, with the first base of the translational initiation codon as +1