Skip to main content

Table 6 DNA primers

From: Occurrence, diversity and community structure of culturable atrazine degraders in industrial and agricultural soils exposed to the herbicide in Shandong Province, P.R. China

Target gene Primera Nucleotide sequences (5' → 3') Reference
atzA atzA250f TCGCACGGGCGTCAAT This study
atzA655f CGCTCCTGCCACTACCA This study
atzA650r TGTCACCGCCGTGGTAG This study
atzA757r GCGGGACTCATCCCATGAAT This study
atzA982r TACGGAGTCATTACTATTCCCGTT This study
atzB B1f AGGGTGTTGAGGTGGTGAAC [51]
B1r CACCACTGTGCTGTGGTAGA [51]
atzB181f GGGTGTTGAGGTGGTGAACT This study
atzB426f ACCAGTACAACTACAGCCGC This study
atzB681f TGATTGCCTACCCGGAAACC This study
atzB316r TCTTCATCCACCAGGGCAAA This study
atzB662r GGTTTCCGGGTAGGCAATCA This study
atzB919r CTTCGGCACCCACCAGAAA This study
atzC atzCf GCTCACATGCAGGTACTCCA [21]
atzCr TGTACCATATCACCGTTGCCA [21]
Cf GCTCACATGCAGGTACTCCA [51]
C1r TCCCCCAACTAAATCACAGC [51]
atzC340f TGTGATAGAACATGCTCACATGC This study
atzC552r TAGCAGGATCAACTCCCCCA This study
trzN C190-10 CACCAGCACCTGTACGAAGG [22]
C190-11 GATTCGAACCATTCCAAACG [22]
trzN1114f AATGGCAACCAGGGGATCAG This study
trzN1271f GAGCACCTGACCATTCACGA This study
rrs 63KWf CAKGCCTWACACATGCAAGTC [62], this study
1389r ACGGGCGGTGTGTACAAG [62], this study
ERIC ERIC2 AAGTAAGTGACTGGGGTGAGCG [64]
BOX BOXA1R CTACGGCAAGGCGACGCTGACG [65]
  1. aNumbers in designations of the primers designed in this work are positions of their 3' nucleotides in coding direct sequences of the respective genes: atzA, atzB, atzC from Pseudomonas sp. ADP (GenBank accession no. U66917, regions 34964-36388, 44487-45932, 70219-71430 respectively), and trzN from Nocardioides sp. C190 (GenBank accession no. AF416746); f – forward, r - reverse