Skip to main content

Table 4 Oligonucleotide primers

From: Bacillus subtilis 5′-nucleotidases with various functions and substrate specificities

Name Sequence (5′–3')a Restriction site
araL-F gggaattccatatgcgtattatggccagtcatgat NdeI
araL-R ccgctcgagtatcagaatcccctcctcagc XhoI
yutF-F cgcggatccatgaaaacatataaagggtattta BamHI
yutF-R cccaagcttaatgtatggaatccattcagt HindIII
ysaA-F cgcggatccatgaaagccgtattttttgattta BamHI
ysaA-R ccgctcgagtttctctaatataggaaacaa XhoI
YqeG-F gggaatccatatgttaaaaaagtttttt NdeI
YqeG-R cccaagcttttactcctcccactgaat HindIII
ycsE-F gggaattccatatgtctgtccaaagagaagatgta NdeI
ycsE-R ccgctcgagtagtacccaatggcgaatcgcttta XhoI
yktC-F cgcggatccatgacaaattggacggaaatcgat BamHI
yktC-R cccaagcttcttccgagcatgaagatactc HindIII
ycsE-1 gtttattgatggcgtgac  
ycsE-2 ctgtgtagccttgagagtgatgaacagacatatatgtacctctc  
ycsE-3 tcactctcaaggctacacag  
ycsE-4 cgcaagcttcaaaaattatatggag  
ycsE-5 ctccatataatttttgaagcttgcggggtactataaaaaaagagagtcc  
ycsE-6 aacacttcatttgcggtc  
yktC-1 gttcgcctagagctgtaagcttc  
yktC −2 gccgatgataagctgtcaaagcaatctcatcgatttccgtcc  
yktC −3 tttgacagcttatcatcggc  
yktC −4 ttataaaagccagtcattaggc  
yktC −5 gcctaatgactggcttttataagtgctagccggaaacccatc  
yktC −6 gaacatctatcaccagacgacatc  
yqeG-d1 gacataatgcgccatttgatggttg  
yqeG-d2 gcttgagtcaattccgctgtcgctcaaacgaaaagggcacattcag  
yqeG-d3 cgacagcggaattgactcaagc  
yqeG-d4 cgcaagcttacgataaacccagc  
yqeG-d5 gctgggtttatcgtaagcttgcgcaaaacccgcacccttccc  
yqeG-d6 caggcagagcatatggatacg  
yqeG-s1 ccttccagggtatgtttctc  
yqeG-s2 gatactgcactatcaacacactctttcgacatggatgagcgatgatg  
yqeG-s3 aagagtgtgttgatagtgcagtatc  
yqeG-s4 caacaagctggggatccg  
yqeG-s5 cggatccccagcttgttgcgacaatcattttgaaagaaagaaaaaggg  
yqeG-s6 gatgacctcgtttccaccggcaaccttttccatttcttactcctcc  
yqeG-s7 ccggtggaaacgaggtcatc  
yqeG-s8 cacaaattaaaaactggtctgatcggcctaactcacattaattgcgttg  
yqeG-s9 cgatcagaccagtttttaatttgtg  
yqeG-s10 ttaacaaaattctccagtcttcacatcg  
  1. aRestriction enzyme cleavage sites are underlined