Skip to main content

Table 1 Primers used in this study

From: DNA-based culture-independent analysis detects the presence of group a streptococcus in throat samples from healthy adults in Japan

Primer Nucleotide Sequence (5’-3’) Amplicon size (bp) Reference
16S rRNA Fwd-AAGAGAGACTAACGCATGTTAGTAAT
Rev-ATTTTCCACTCCCACCATCA
300 This study
V-Na+-ATPase Fwd-GTCGATTTTGCCACGTACCG
Rev -TGCATGGTCAACTCAATCATTTGC
121 Hung et al. 2012 [27]
Vir SBR-AGACATGAGCGCAATGGCAAGTTTATCAAATGGTAATTTTTG
VUF-AAACCGTATCTTTGACGCACTCGAGGACAATTTGCGAGATTAG
Variable Gardiner et al. 1995 [29]
emm Primer1 –TATT(C/G)GCTTAGAAAATTAA
Primer 2– GCAAGTTCTTCAGCTTGTTT
Variable CDC a
emm conserved Fwd-AATARACASTATTCGCTTAGAAAATTA
Rev-GCTTAGTTTTCTTCTTTGCG
Variable This study
  1. Abbreviations: Fwd forward, Rev reverse, a CDC Centers for Disease Control and Prevention
  2. For the SBR primer, G (shown in bold) replaces T in the original reference