Skip to main content

Table 2 Primers used in this study

From: Enterococcus hirae LcpA (Psr), a new peptidoglycan-binding protein localized at the division site

Primer Sequence (5′ to 3′) Application
32 ctttaagaaggagatatacatatgAAAACATTTCAAAAAGTGATTTTAGGTCTATTG Cloning lcpA in pET-22b
33a gtggtggtggtggtgTTGGTCTAAAAACTGATTGATTGCTAATTG Cloning lcpA and lcpA 30–293 in pET-22b
43 ctttaagaaggagatatacatatgTCTTCAACGAGTCGAGCAGACGATGTA Cloning lcpA 30–293 in pET-22b
CF9 CATGCCATGGCAAAAACATTTCAAAAAGTGATTTTAGGTCTATTG Cloning lcpA in pCIPblaM
CF42a CGAGCTCTTGGTCTAAAAACTGATTGATTG Cloning lcpA in pCIPblaM
  1. Reverse primers are indicated by a. Underlined sequences are restriction sites engineered for cloning. Bases noted in small letters are homologous to bases of the linearized vector when using In-Fusion® HD Cloning Kit