Skip to main content

Table 1 List of primers used in this study

From: Colonization of Enteroaggregative Escherichia coli and Shiga toxin-producing Escherichia coli in chickens and humans in southern Vietnam

Target genes Primer name Primer sequences (5′-3′) Fragment size Reference
aggR aggR_F AAGCAGCGATACATTAAGACG 424 This study
aggR_R TGCTTTGCTCATTCTTGATTGC
stx1 stx1_F TGATGATTGATAGTGGCACAGG 299 This study
stx1_R AGAAGTAGTCAACGAATGGCG
stx2 stx2_F ACATCGGTGTCTGTTATTAACC 666 This study
stx2_R TTGACTCTCTTCATTCACGGC
wzx O104 wzxO104_F GGTTTTATTGTCGCGCAAAG 337 [20]
wzxO104_R TATGCTCTTTTTCCCCATCG
fliC H4 fliCH4_F ACGGCTGCTGATGGTACAG 244 [20]
fliCH4_R CGGCATCCAGTGCTTTTAAC