Skip to main content

Table 2 Oligonucleotide primers for C. perfringens toxin gene detection

From: Diversity of Clostridium perfringens toxin-genotypes from dairy farms

Primer Sequence (5′–3′) Amplificationproduct size [bp] Primer concentration [mM] Toxin Coding toxin gene
Multiplex PCR (major toxin genes)a
 CPA5L AGTCTACGCTTGGGATGGAA 900 200 alpha cpa
 CPA5R TTTCCTGGGTTGTCCATTTC   200   
 CPBL TCCTTTCTTGAGGGAGGATAAA 611 400 beta cpb
 CPBR TGAACCTCCTATTTTGTATCCCA   400   
 CPIL AAACGCATTAAAGCTCACACC 293 200 iota iap
 CPIR CTGCATAACCTGGAATGGCT   200   
 CPETXL TGGGAACTTCGATACAAGCA 396 200 epsilon etx
 CPETXR TTAACTCATCTCCCATAACTGCAC   200   
Duplex PCR (minor toxin genes)a
 CPEL GGGGAACCCTCAGTAGTTTCA 506 400 entero cpe
 CPER ACCAGCTGGATTTGAGTTTAATG   400   
 CPB2L CAAGCAATTGGGGGAGTTTA 200 200 beta-2 cpb2
 CPB2R GCAGAATCAGGATTTTGACCA   200   
Singleplex PCR for cpa detectionb
 224 AGGAACTCATGCTATGATTGTAACTCAAGG 775 200 alpha cpa
 972inverse ACCACTAGTTGATATGTAAGCTACTAG   200   
PCR for cpb2 variantsc
 CPB2ATYPF ATTATGTTTAGGAATACAGTTA 304 200 beta-2 atypical cpb2aty
 CPB2CONF CAATTGGGGGAGTTTATCCACAA 741 200 beta-2 consensus cpb2con
 CPB2R CAATACCCTTCACCAAATACTC   200   
  1. aBaums CG, Schotte U, Amtsberg G, Goethe R. Diagnostic multiplex PCR for toxin genotyping of Clostridium perfringens isolates. Vet Microbiol. 2004;100:11–16
  2. bSchlapp T, Blaha I, Bauerfeind R, Wieler LH, Schoepe H, Weiss R, Baljer G. Synthesis and evaluation of a nonradioactive gene probe for the detection of Clostridium-perfringens alpha-toxin. Mol Cell Probe. 1995;9:101–109
  3. cJost BH, Billington SJ, Trinh HT, Bueschel DM, Songer JG. Atypical cpb2 genes, encoding beta2-toxin in Clostridium perfringens isolates of nonporcine origin. Infect Immun. 2005;73(1):652–6
\