Skip to main content

Table 2 Gene and primers used for qRT-PCR (sequence 5′ → 3′)

From: Novel cationic peptide TP359 down-regulates the expression of outer membrane biogenesis genes in Pseudomonas aeruginosa: a potential TP359 anti-microbial mechanism

Gene Forward primer Reverse primer
oprI GCTCTGGCTCTGGCTGCT AGGGCACGCTCGTTAGCC
oprF CTGGACGCCATCTACCACTT CTGTCGCTGTTGATGTTGGT
oprL AACAGCGGTGCCGTTGAC GTCGGAGCTGTCGTACTCGAA
opr86 CGTCTACATCACCGTCAACATC GGCGCTTCACTTCCTCTTC
uppS CGGTGATCGAGGTCTGC GGACGCTGCCAGTTCTC
acpP CCATCGAAGAACGCGTTAAG CCTGAACGGTGGTGATCTTT
ftsZ GCGGTATCTCCGACATCATC AGGTTGACGTCTTCCAGCAG
ftsA CGACGAGCTGTTCACCCTGG GCGCCTTCCATCTTCGAGGT
ampR CGCGCCATCCCTTCATC ATGTCGACGCGGTTGTTGT
lasR GGACAGCCAGGACTACGAGA ATGGACGGTTCCCAGAAAAT
rpoD GCGACGGTATTCGAACTTGT CGAAGAAGGAAATGGTCGAG