Skip to main content

Table 2 Primers used in this study

From: Investigating the potential role of non-vls genes on linear plasmid 28–1 in virulence and persistence by Borrelia burgdorferi

P330 GTCTGTGGTAGTTACTAGTTACTTTAAATACC Forward primer for bbf27-30 target
P331 CCGAAATATTCCTATCTACTTAACAAC Reverse primer for bbf27-30 target
P332 CCGGCCGGCGAATTTTGAGTCCTCTAGTGAGTTGTG Left primer for inverse PCR of bbf27-30 target in pJET with NgoMIV site
P333 CCGGCTAGCGTTATAAGCCCTCCATTTGATAATTTTTTG Right primer for inverse PCR of bbf27-30 target in pJET with NheI site
P366 CTTAATTTGTGACCGCCATTAGAGC Forward primer for bbf27-30 screen
P367 GGGTTTTTTGAAACAAATCTTGC Reverse primer for bbf27-30 screen
P411 GAGTTTCTGGTAAGATTAATGCTC Forward primer for flaB RT-qPCR
P412 CATTTAAATTCCCTTCTGTTGTCTGA Reverse primer for flaB RT-qPCR
P413 AGAGGTTTGTCACAAGCTTCTAGAAATACTTCAAAGGC flaB RT-qPCR probe
P482 GAACAAGCTGAAAAATATAAAAAAGTAATG Forward primer for PCR amplification of bbf19-22 target
P483 CTGGTTACTTTTTAGATAGAGTTTTTATAGAG Reverse primer for PCR amplification of bbf19-22 target
P484 CCGGCCGGCGGTTTAGACTTGCATTTA TATCTCC Left primer for inverse PCR bbf19-22 target in pJET with NgoMIV site
P485 CCGGCTAGCCCCCTCCTTATATTTTTTTATATATAAAAG Right primer for inverse PCR of bbf19-22 target in pJET with NheI site
P486 GCTTATAAGCTTTATTAACACCCATATATTC Forward primer for bbf19-22 screen
P487 CCCGCGAGGTATATTTATTTATATTG Reverse primer for bbf19-22 screen
P709 TTACGGATTCTAATGCGGTTT Forward primer for ospC RT-qPCR
P710 TTTACCAATAGCTTTAGCAGCAA Reverse primer for ospC RT-qPCR
P711 TGTGAAAGAGGTTGAAGCGTTGCTG. ospC RT-qPCR probe
P828 CTGCACTACCACAAGAGATTGCA Forward primer for PCR screen for left-end sequence of lp28-1
P829 CTCTTCTCCTCTCTTCTTCTCTCT Reverse primer for PCR screen for left-end sequence of lp28-1
P830 CATTTCTAGTCTAGATTGCAGTTATTTCTAAAATTAACT Forward primer for PCR amplification for lp28-1 left-end deletion target
P831 GTGCCCAGGCGGCCGTCCTTATTCTTCTGGCATAGAAGT Reverse primer for PCR amplification for lp28-1 left-end deletion target