Skip to main content

Table 1 Primers for ESBLs detection by PCR

From: Synergistic effects of baicalein with cefotaxime against Klebsiella pneumoniae through inhibiting CTX-M-1 gene expression

Primer Sequence(5’ → 3’) Nuleotide position Tm Genbank accession No. Size
SHV-F TCTCCCTGTTAGCCACCCTG 224-243 59 °C AF124984 593 bp
SHV-R CCACTGCAGCAGCTGCCGTT 797-816
TEM-F GTATCCGCTCATGAGACAATA 154-174 56 °C AB194682 717 bp
TEM-R AGAAGTGGTCCTGCAACTTT 851-870
CTX-M1-F CGCTTTGCGATGTGCAG 264-280 56 °C X92506 551 bp
CTX-M1-R ACCGCGATATCGTTGGT 798-814
CTX-M9-F ATGGTGACAAAGAGAGTGCA 132-151 56 °C AJ416345 868 bp
CTX-M9-R CCCTTCGGCGATGATTCTC 983-1000