Skip to main content

Table 1 Primers used to amplify the fragments of the genes encoding the toxins and adhesins

From: Prevalence of adhesin and toxin genes in E. coli strains isolated from diarrheic and non-diarrheic pigs from smallholder herds in northern and eastern Uganda

Target Primer sequence (5’ to 3’) Conc. (pMol/μL) Product size (bp) Reference
 STa F: TTT CCC CTC TTT TAG TCA GTC AAC TG 0.05 160 [55]
R: GGC AGG ATT ACA ACA AAG TTC ACA G 0.05   
 STb F: GCC TAT GCA TCT ACA CAA TCA 0.05 114 [55]
R: TGC TCC AGC AGT ACC ATC TCT AAC CC 0.05   
 LT F: CCG GAT TGT CTT CTT GTA TGA 0.3 236 [56]
R: TGT TCC TCT CGC GTG AT 0.3   
 F6 F: TCT GCT CTT AAA GCT ACT GG 0.1 333 [57]
R: AAC TCC ACC GTT TGT ATC AG 0.1   
 F4 F: ATC GGT GGT AGT ATC ACT GC 0.5 601 [57]
R: AAC CTG CGA CGT CAA CAA GA 0.5   
 EAST1 F: TGC CAT CAA CAC AGT ATA TC 0.2 107 [56]
R: GAG TGA CGG CTT TGT AGT C 0.2   
 Stx2e F: CCA GAA TGT CAG ATA ACT GGC GAC 0.1 322 [55]
R: GCT GAG CAC TTT GTA ACA ATG GCT G 0.1   
 F41 F: GCA TCA GCG GCA GTA TCT 0.2 380 [58]
R: GTC CCT AGC TCA GTA TTA TCA CCT 0.2   
 F5 F: TGG GAC TAC CAA TGC TTC TG 0.2 450 [57]
R: TAT CCA CCA TTA GAC GGA GC 0.2   
 F18 F: GTG AAA AGA CTA GTG TTT ATT TC 0.7 510 [59]
R: CTT GTA AGT AAC CGC GTA AGC 0.7   
 AIDA-I F: TGCAAACATTAAGGGCTCG 0.05 450 [19]
R: CCGGAAACATTGACCATACC 0.05