Skip to main content

Advertisement

Table 1 Oligonucleotides used in this work

From: Site-specific bacterial chromosome engineering mediated by IntA integrase from Rhizobium etli

Name Sequence a Genome location b Source or reference
chr_left_in_hind AAAAAAGCTTTCCCGGCTCCGACAG 1108084 Chr This work
chr_right_in_eco AAAAGAATTCCCGGTGTCTGCTTCCA 1108560 Chr This work
chr_left_out CGGAACACCGGATCTCA 1107995 Chr This work
chr_right_out CGTGCCCGCTTTTGTC 1108840 Chr This work
Plac-out CGCGGAACCCCTATTTG   10
CasNot-Ter-out CCGTCTGTGATGGCTTCC   10
UpattA1 CTGGATCCCAAAGGTCGCTCCTGAAT 2252 p42a 8
LwattA1 CGAATTCATTTTCCCGAGAATAACATG 2687 p42a 8
Lw23bp CGGATCCTCCGATAAGCATTACTTATCGGACTTAAGT 5765 p42d 8
Up23bp CGGATCCTCCGATAAGCATTACTTATCGGACTTAAGT 5743 p42d 8
M13 reverse CAGGAAACAGCTATGAC   ThermoFisher Scientific
LwattD1 CGAATTCCGGCGTTTGCATCTCGTTA 5875 p42d 8
ChrleftD CTGGATCCTCCGATAAGTAA   This work
ChrightD CGAATTCTGATTTGCGGGCG   This work
G18lw CGGATCCTCCGATAAGCATTACTTATCGGACTTAAGT attG18mob This work
G18up GCCTAGGAGGCTATTCGTAATGAATAGCCTGAATTCA attG18mob This work
Link-PstxNot AGCGGCCGCTTGCA NA  
  1. aAll oligonucleotides are shown in the 5′ to 3′ direction. Built-in restriction sites, depicted in italics, are EcoRI (GAATTC) BamHI (GGATCC) HindIII (AAGCTT) NotI (GCGGCCGC)
  2. bThe location is indicated by the first 5′ nucleotide and the replicon where the sequence is located. Accession numbers are p42a (NC_007762), p42d (NC_004041), Chr (NC_007761) of R. etli. NA, not applicable (NA)