Skip to main content

Table 1 Oligonucleotides used in this work

From: Site-specific bacterial chromosome engineering mediated by IntA integrase from Rhizobium etli

Name Sequence a Genome location b Source or reference
chr_left_in_hind AAAAAAGCTTTCCCGGCTCCGACAG 1108084 Chr This work
chr_right_in_eco AAAAGAATTCCCGGTGTCTGCTTCCA 1108560 Chr This work
chr_left_out CGGAACACCGGATCTCA 1107995 Chr This work
chr_right_out CGTGCCCGCTTTTGTC 1108840 Chr This work
M13 reverse CAGGAAACAGCTATGAC   ThermoFisher Scientific
  1. aAll oligonucleotides are shown in the 5′ to 3′ direction. Built-in restriction sites, depicted in italics, are EcoRI (GAATTC) BamHI (GGATCC) HindIII (AAGCTT) NotI (GCGGCCGC)
  2. bThe location is indicated by the first 5′ nucleotide and the replicon where the sequence is located. Accession numbers are p42a (NC_007762), p42d (NC_004041), Chr (NC_007761) of R. etli. NA, not applicable (NA)