Skip to main content

Advertisement

Table 2 Primers used in this study

From: Shigella flexneri serotype 1c derived from serotype 1a by acquisition of gtrIC gene cluster via a bacteriophage

Primer name Sequence Description
GtrIc-F(BamHI)a TTAGGATCCAGGGATTCAACTGATTGGC Binds upstream of gtrIC (in gtrB IC ).
GtrIcR2-BamHI TGAGGATCCGACAGGATCAATCACCGC Binds downstream of gtrIC stop codon.
DG_GtrA(Ic)F(SacI) b GTCGAGCTCTTGATGCTAAACTCTCACTTT Binds to sequence 24–44 bp upstream of gtrA IC start codon
  1. aPrimer pair of GtrIc-F(BamHI) and GtrIc-R2(BamHI), was optimal for the production of a single band which corresponded to the gtrIC gene
  2. bPrimer pair of DG_GtrA(Ic)F(SacI) and GtrIc-R2(BamHI) was the best choice for the gtrIC gene cluster