Skip to main content

Table 2 Primers used in this work

From: Identification of the crp gene in avian Pasteurella multocida and evaluation of the effects of crp deletion on its phenotype, virulence and immunogenicity

Primer name Sequence 5’-3’
Ccrp-F1 GCATGCCATGGTGCAAGAACAAATGCAAAC
Ccrp-R1 CGCGGATCCATGGATCGCATTTTAGCAGAG
Ccrp-F2 CGCGGATCCGTGCAAGAACAAATGCAAAC
Ccrp-R2 ATAAGAATGCGGCCGCATTTTAGCAGAGAACCGGG
pET-crp-F GGGGTACCCAAGAACAAATGCAAACTAC
pET-crp-R TGGATCCTTAGTGGTGGTGGTGGTGGTGTCTTGTACCGTAAACGACAATG
Dcrp-1 F CGCATCTGGTGAACCTGTGT
Dcrp-1R TACCTGCAGGATGCGGCCGCGGAAGACCTCCATAAACTAAT
Dcrp-2 F CGCGGCCGCATCCTGCAGGTAATCCCCGGTTCTCTGCTAA
Dcrp-2R GGCACGTTGCACATGAATC
kan-F ATAAGAATGCGGCCGCTCAGTGGAACGAAAACTC
kan-R CCTGCAGGTTAGAAAAACTCATCGAGCATC
Primer 1 AGGTGAAAAAGCCGAGACGC
Primer 2 GCGAACATCCCACCATTTGC
Primer 3 TGTTTGAAGCCTTGATTGAT
Primer 4 CTGATTCAGGTGAAAATATTG
Primer 5 CAATATTTTCACCTGAATCAG
Primer 6 GTCATTTCACCTGAATAAGC