Skip to main content

Table 1 PCR target genes and primers used in this work

From: Susceptibility patterns of Staphylococcus aureus biofilms in diabetic foot infections

Gene Primer Reference
Sequence (5′→3′)
icaA TCTCTTGCAGGAGCAATCAA Arciola et al. (2001) [46]
AGGCACTAACATCCAGCA
icaD ATGGTCAAGCCCAGACAGAG Arciola et al. (2001) [46]
CGTGTTTTCAACATTTAATGCAA
atl CTTCAGCACAACCAAGATC Petrelli et al. (2008) [4]
GGTTACCGACTGCACCGTCAC
pls GTAATACAACAGGAGCAGATGG Petrelli et al. (2008) [4]
GTAGCTTTCCATGTTTTTCCTG
blaZ ACTTCAACACCTGCTGCTTTC Martineau et al. (2000) [38]
TGACCACTTTTATCAGCAACC
mecA TCCAGATTACAACTTCACCAGG Stegger et al. (2012) [24]
CCACTTCATATCTTGTAACG
mecC GAAAAAAAGGCTTAGAACGCCTC Stegger et al. (2012) [24]
GAAGATCTTTTCCGTTTTCAGC
tetK TCGATAGGAACAGCAGTA Ng et al. (2001) [47]
CAGCAGATCCTACTCCTT
tetL TCGTTAGCGTGCTGTCATTC Ng et al. (2001) [47]
GTATCCCACCAATGTAGCCG
tetM GTGGACAAAGGTACAACGAG Ng et al. (2001) [47]
CGGTAAAGTTCGTCACACAC
tetO AACTTAGGCATTCTGGCTCAC Ng et al. (2001) [47]
TCCCACTGTTCCATATCGTCA
msrA TCCAATCATTGCACAAAATC Martineau et al. (2000) [38]
AATTCCCTCTATTTGGTGGT
ermA TATCTTATCGTTGAGAAGGGATT Martineau et al. (2000) [38]
CTACACTTGGCTTAGGATGAAA
ermB CTATCTGATTGTTGAAGAAGGATT Martineau et al. (2000) [38]
GTTTACTCTTGGTTTAGGATGAAA
ermC CTTGTTGATCACGATAATTTCC Martineau et al. (2000) [38]
ATCTTTTAGCAAACCCGTATTC
aac(6′)–aph(2″) TTGGGAAGATGAAGTTTTTAGA Martineau et al. (2000) [38]
CCTTTACTCCAATAATTTGGCT
norA TTCACCAAGCCATCAAAAAG Pourmand et al. (2014) [48]
CTTGCCTTTCTCCAGCAATA