Skip to main content

Advertisement

Table 2 Bacterial strains, plasmids and oligonucleotides used in this study

From: Biochemical and spectroscopic characterization of purified Latex Clearing Protein (Lcp) from newly isolated rubber degrading Rhodococcus rhodochrous strain RPK1 reveals novel properties of Lcp

Strain or plasmid Relevant characteristics Reference
E. coli JM109 Plasmid storage and expression of lcp  
E. coli XL1-blue Transformation strain Stratagene
Rhodococcus rhodochrous RPK1 Wild type strain, degrades rubber this study
 pUC9::strep-lcp K30 (SN5339) Cloning vector for lcp K30 , Apr [18]
 pUC9::strep-lcp Rr (SN5759) Cloning vector for lcp Rr , Apr this study
 p4782.1 (SN3513) Mobilizable broad host range [37]
  Expression vector, Kmr  
 p4782.1::strep-lcp K30 (SN5496) Coding sequence of strep-lcp K30 under [18]
  Rhamnose promoter control, Kmr  
 p4782.1::strep-lcp Rr (SN5760) Coding sequence of strep-lcp Rr under this study
  Rhamnose promoter control, Kmr  
Oligonucleotides   
 LcpRr-complete_for GCAGAATCCACATGTCCT  
 LcpRr-complete_rev CGACAAACCCACAGATGA  
 LcpRr-mature-PstI_for GGGCCTGCAGCGGCCCTGGAGGTGGTCGCC  
 LcpRr-mature-HindIII_rev CCGGTAAGCTTTCAGGGATAGTTGGG  
 16S-universal-for GAGTTTGATC(A/C)TGGCTCAG  
 16S-universal-rev GG(C/T)TACCTTGTTACGACT  
 16S-Rr-complete_for CTGGCGCGGTGCTTAAC  
 16S-Rr-complete_rev CAGTAATTCCGGACAACG  
  1. Kanamycin resistance (Kmr), Ampicillin resistance (Apr)