Skip to main content

Table 2 Primers for PCR amplification of the connection region of integron and ISCR1

From: New structures simultaneously harboring class 1 integron and ISCR1-linked resistance genes in multidrug-resistant Gram-negative bacteria

Type of complex class 1 integron No. Primer name Sequence (5′–3′)
A I aadA2 + bla CTX-9F CGTTGCCTTGGTAGGTCC
II aadA2 + bla CTX-9 up R TTGCTTGCCATAGTCATCTT
IX aadA2 + bla CTX-9 down F CCCCAAGGAGCCCATTC
X aadA2 + bla CTX-9R GGTATTCAGCGTAGGTTCAGT
B I aadA2 + qnrA1 F GTTGTCCCGCATTTGGT
II aadA2 + qnrA1 up R GGTTGAGCGAGAAGGTTTT
IX aadA2 + qnrA1 down F GCGTGAGCTGCCACCAGAA
X aadA2 + qnrA1 R TCTTATGGCTGACTTGATTGTAG
C I aadA1 + bla DHA-1 F ATCTGGCTATCTTGCTGAC
II aadA1 + bla DHA-1 up R TTCCGAGAAGGTGATTGC
IX aadA1 + bla DHA-1 down F CCAACACTGCTCAACACT
X aadA1 + bla DHA-1 R GGTGGCGATTGTGATTCT
D I dfrA25+ sapA F ACGAAGCGATGGGTAGA
II dfrA25+ sapA up R AGCCCTCACGAGTTGTTAT
IX dfrA25+ sapA down F CAAGAAGCCCGACAAAT
X dfrA25+ sapA R TGGGAGGTGCTGGATAA
E I aadA2+ sapA F CGTTGCCTTGGTAGGTC
II aadA2+ sapA up R AACCGCACAATCTCGTC
IX aadA2+ sapA down F CGCTGCTGATAGACGAAG
X aadA2+ sapA R TGGGAGGTGCTGGATAA
F I aadA16+ sapA F GTTGTTCCTTGGCGTTATC
II aadA16+ sapA up R TCAGCAATATCGGGATAGAG
IX aadA16+ sapA down F AGACGATACGCTGACTCA
X aadA16+ sapA R ATGACCGACTGCTTGATG
G I dfrA27 + short chain F GCAATGAGGGAGCTAAAGA
II dfrA27 + short chain up R TTGGGTTCAGGGTGCTAT
IX dfrA27 + short chain down F CAAGAAGCCCGACAAATC
X dfrA27 + short chain R TTCACGAGCATAGGCAATA
H I aacA4 + bla PER F CCCGAGGTCACCAAGA
II aacA4 + bla PERup R GCACCATCCCACATAAGA
IX aacA4 + bla PERdown F AAGAGGGCGAAGACGA
X aacA4 + bla PER R TCCATCAGGCAACAGAAT
I I aadA5 + bla PER F ACTGGTCTCATTGCTCCTA
II aadA5 + bla PER up R CGAAGAACCGCACAATCT
IX aadA5 + bla PER down F CAACACTGCTCAACACTG
X aadA5 + bla PER R ATTGGTTCGGCTTGACTC
J I aadA24 + bla PER F CATCATTCCGTGGCGTTA
II aadA24 + bla PER up R GACACCGAGACCAATAGC
IX aadA24 + bla PER down F AATCCAACACTGCTCAACA
X aadA24 + bla PER R CATCATTCCGTGGCGTTA
K I arr-3 + qnrA1 F GGTAATCCAACACAGTCCTA
II arr-3 + qnrA1 up R GTCCGCCTCAGCAATATC
IX arr-3 + qnrA1 down F TCCAACACTGCTCAACAC
X arr-3 + qnrA1 R CCAGAGTATCCGCAATCC
L I bla PSE-1 + dfrA10 F TTATGGCGGCGTTAGATG
II bla PSE-1 + dfrA10 up R CGAGACCAATAGCGGAAG
IX bla PSE-1 + dfrA10 down F ATATTGAAGTCTGCGAACAC
X bla PSE-1 + dfrA10 R CGTGCTCTGTGATAGTTGA
- III common 1 791 F TATTGCTGAGGCGGACTG
IV common 1 791 R CATTGGAGGAGGTCGTTG
V common 2 1054 F GGCTTCCGCTATTGGTC
VI common 2 1054 R TTGCTTGCCATAGTCATCTT
VII common 3 1727 F TCGCCCACTCAAACAAA
VIII common 3 1727 R GCTCCTCATCCGAAGTATCT
  A - CCTGTCGGTGTTGCTTAT
  B - GTTGCTTGCCATAGTCATC
  1. Types of complex class 1 integron correspond to Fig. 2;
  2. Primers No. correspond to Fig. 1