Skip to main content

Table 2 Oligonucleotides used in this study

From: Convenient broad-host-range unstable vectors for studying stabilization cassettes in diverse bacteria

No Name Sequence
1 klcApRA3L GCGCATGCGGGAGCGTGATCGTTACGGT
2 klcApRA3R GCGGATCCATTGCAGCCATACGGCGAGG
3 klcAsmaF GGCCCGGGTGCTCGTCTCGTCGGTCTG
4 xylEPscR GGACATGTCATCTGCACAATCTCTGCA
5 KBRK2Apa CCGAATTCGGGCCCGAAGATGGAGATTTCCCAATGACTGC
6 KBRK2Sal CCGTCGACCGCTGTCTTTGGGGATCAGCCCTC
7 lacOMCS1 CATGGAATTGTGAGCGCTCACAATTTCAGATCTGAATTCTACGTACTCGAGCTCGGAATTGTGAGCGCTCACAATTTCA
8 lacOMCS2 CGCGTGAAATTGTGAGCGCTCACAATTCCGAGCTCGAGTACGTAGAATTCAGATCTGAAATTGTGAGCGCTCACAATTC
9 parSbg2a GATCGGTTGCTTGTTCCACGTGGAACAAGGCCG
10 parSbg2b GATCCGGCCTTGTTCCACGTGGAACAAGCAACC
11 NrulacIF GGTCGCGACTGAATCCGGTGAGAATGG
12 PvulacIR CGCGATCGATAAGCTTGCAATTCGCG
13 oriTRK2Fs ACGGTCGACACATGTCTGGTTGGCTTGGTTTCATC
14 oriTRK2Rs CGGAATTCACATGTTTGCCAAAGGGTTCGTGTAG
15 oriTRA3F CGCGTCGACACATGTTTTAGCACAAGCGGCGGCAG
16 oriTRA3R CGGAATTCACATGTAGTTAGGGGAAGCCGACGAG
17 Nco ACCATGGTCATG
  Primers used in site-directed mutagenesis
18 muttrfA RK2 GTCCTTGAGAAAGGAGACgtc gGTTTAGCTA
19 muttrfA RK2 CCAATGTTTAGCTAAACc gacGTCTCCTTTC
20 xhoF8180 CGGGCCGTCGGCTCGaGCATCATATCGAC
21 xhoR8180 CGATATGATGCtCGAGCCGACGGCCCGC
22 apaF9950 CTTTCTGGTTGGCCGgGcCCAAAGTTTTtATCGTTTGGTTTCC
23 apaR9950 GAAACCAAACGATaAAAACTTTGGgCcCGGCCAACCAGAAAGGC
24 Ppu618F CGCTGCAGAGGCCAGACCCCGTGAAATT
25 Ppu618R GCAAGCTTGGTCAGCATAGTCCACCTCA
  Primers used for Real Time qPCR
26 galKF ATGATCTTTCTTGCCGAGCG
27 galKR AGCAGCTTTATCATCTGCCGC
28 trfAF GTGAAGATCACCTACACCGGC
29 trfAR TGGCAAAGCTCGTAGAACGTG
30 repBRA3F CATCGAGAAGCAAAAGGCG
31 repBRA3R CCAACTTGCGTAGGTCTTCCAG
  1. Restriction enzyme recognition sites are in bold, mutated nucleotides are indicated by lowercase, parS palindrome is underlined