Skip to main content

Advertisement

Table 4 PCR primers used in C. trachomatis conventional PCR and real-time PCR diagnosis. For nested PCR amplification of Momp and plasmid, outer primer pairs were used at first round PCR, while inner primer pairs were used at second round PCR amplification. For real-time PCR diagnosis, Momp inner primer pairs, plasmid Pgp8 inner primer pairs and plasmid Pgp1 primer pairs were used

From: Prevalence of plasmid-bearing and plasmid-free Chlamydia trachomatis infection among women who visited obstetrics and gynecology clinics in Malaysia

Target genes Primer Sequence (5′-3′) Amplicon size
Momp Outer forward TTGTTTTCGACCGTGTTTTG 455 bp
  Outer reverse AGCRTATTGGAAAGAAGCBCCTAA  
  Inner forward AAACWGATGTGAATAAAGARTT 395 bp
  Inner reverse TCCCASARAGCTGCDCGAGC  
Plasmid Pgp8 Outer forward TTGGCYGCTAGAAAAGGCGATT 212 bp
  Outer reverse TCCGGAACAYATGATGCGAAGT  
  Inner forward AACCAAGGTCGATGTGATAG 150 bp
  Inner reverse TCAGATAATTGGCGATTCTT  
Plasmid Pgp1 Forward TTCTTTGATGGCTTCCCAAC 456 bp
  Reverse ACGATTTTCTCCAACCGATG  
β-globin Forward GAAGAGCCAAGGACAGGTAC 268 bp
  Reverse CAACTTCATCCACGTTCACC