Skip to main content

Advertisement

Table 3 Oligonucleotides used in this study

From: Purification and genetic characterization of gassericin E, a novel co-culture inducible bacteriocin from Lactobacillus gasseri EV1461 isolated from the vagina of a healthy woman

Name Sequence (5′-3′)
G1-F GAAGTAACAAGTGGCTTAGAT
GatX-R CCTATTACAAACGATATGGC
GatA-F AACATTGGCTAACATAGTTG
GatA-R CATGCTATTGGAACATAGTG
GT1-F TGAAAAATAGTTAATTGATAACTTAAGA
GT1-R TTGCCCCAATAGCCAA
GT2-F GGAGCTTTTGCATATTGAG
GT3-F TTAGTCAGAATCGTCGG
GT4-F GCAAGATCCAAATGCAC
GT5-F TTGCGGCGTTGCTT
GT6-F GCGATACATCAGGCAT
GT7-F CAACCGCGACTTCAA
GT8-R AATAGCGGCTGGAATAATAA