Skip to main content

Advertisement

Table 4 Primers used for 5′- RACE

From: The ATP-dependent RNA helicase HrpB plays an important role in motility and biofilm formation in Xanthomonas citri subsp. citri

Primers Sequences
SP1 CATAGTTCTGATACTGGGGCAGC
SP2 GGCCAGACCAGCAGTGACCTG
SP3 TCGTATTGCGTTTTACCCGG