Skip to main content

Advertisement

Table 3 Primers used for qRT-PCR

From: The ATP-dependent RNA helicase HrpB plays an important role in motility and biofilm formation in Xanthomonas citri subsp. citri

Genes Sequences
gyrA (XAC1631) F, GCCTACATTTTGACGGCCAC
R, ACCGACGAAGTGCTGTTGAT
fimA (XAC3241) F, GAAGCAACAGGGTTTCACGC
R, TATGTTGCCAAGTCGCAGGT
fimA2 (XAC3240) F, TAGCAGTCGCAGTCAAACCA
R, TTGCGGGATCGCTATGGAAG
pilB (XAC3239) F, ATTGCTGGCCGAAGGATTCA
R, TAATGCCGATGACCGACGAG
pilT (XAC2924) F, GAATTCCTCGTAATCGCGCC
R, CAGGTCCGATGCCTTGTTCT