Skip to main content

Advertisement

Table 2 Oligonucleotides used for mutant and complement strains construction in this work

From: The virulence factor ychO has a pleiotropic action in an Avian Pathogenic Escherichia coli (APEC) strain

Primer Sequence
Amplification of the Cm cassette
Forward GAATTTTTTCGCTATAGTGTAGGCTGGAGCTGCTTC
Reverse GAATTTTTTCGCTATACATATGAATATCCTCCTTAG
Mutagenesis  
Forward TATTCTTTAGGGCTATGGTTTTTCATTTTTTACCGGAAGTTACCGACGTTGTGTAGGCTGGAGCTGCTTC
Reverse AGTCTCGCGTGGAAGCTGCGGTATGGGTGCATCAGGAGCGCATTTTCTGACATATGAATATCCTCCTTAG
Mutagenesis confirmation
Forward TACCGGAAGTTACCGACGTT
Reverse ATCAGGAGCGCATTTTCTGA
Genetic Complementation
Forward GCTATAGTCGACGCGAGAAAATACGACAAAAG
Reverse GTAAGGATCCCACATGCTGAAGAAAATGAA