Skip to main content

Advertisement

Table 2 Oligonucletide sequences for PCR based amplification and sequencing

From: Relation between tetR and tetA expression in tetracycline resistant Escherichia coli

Primer Sequence Application
TetA-ybeM for: 5’-ATGCTGGTGGCACTTCAGGCAGGAAACATCGTCGCCCGTTCAATCGTCACCCTTTCTCGG -3’ Recombination
  rev: 5’-AGGCGGCAGGAAGTACCAGGATTTCAGCTCCCTGTCTATGTGCAACGGGAATTTGAAG-3’  
TetA/ybeM for: 5’-GAAGCATTGCTGGCGCGCGATG-3’ Proof of insertion
  rev: 5’-TTCTCCAAAGCCCGCGACGCAG-  
TetA for: 5’-AAGAATCCGCGCGTTCAATCG-3’ Sequencing
  rev: 5’-GCCCGGCACCGGCATAAT-3’  
TetR for: 5’-TCGGATCCTCAATCGTCACCCTTT-3’ Sequencing
  for: 5’-CGCATCCATGCCGGCACG-3’  
NusG for: 5’-GTCCGTTCGCAGACTTTAAC-3’ qPCR
  rev: 5’-GCTTTCTCAACCTGACTGAAG-3’  
GapA for: 5’-ACTGACTGGTATGGCGTTCC-3’ qPCR
  rev: 5’-GTTGCAGCTTTTTCCAGACG-3’  
TetA-qPCR for: 5’-CGGTCTTCTTCATCATGCAAC -3’ qPCR
  rev: 5’-GTCCCAGTGAAAGCGATCC-3’  
TetR-qPCR for: 5’-CCGAATGCGTATGATTCTCC-3’ qPCR
  rev: 5’-CGCTTTACTGGCACTTCAGC-3’