Skip to main content

Table 1 Bacterial strains, plasmids and primers used in this work

From: Two superoxide dismutases from TnOtchr are involved in detoxification of reactive oxygen species induced by chromate

Strain or Plasmid Relevant Characteristic(s) Reference or Source
Bacterial Strains   
O. tritici 5bvl1 Type strain; Ampr; Cr(VI)r  
chrC mutant Single mutant of 5bvl1; chrC mutated This study
chrF mutant Single mutant of 5bvl1; chrF mutated This study
chrC/chrF mutant Double mutant of 5bvl1; chrC and chrF mutated This study
E. coli S17-1 Conjugation donor strain 22
E. coli 21(DE3) F ompT hsdS (rB -, mB ) gal dcm lacY1(DE3) Novagen
Plasmids   
pJQ200SK Suicide vector; sacB; Gmr ATCC
pET30a Kmr, expression plasmid Novagen
petChrC pET30a for overproduction of ChrC with an C-terminal hexahistidine tag This study
petChrF pET30a for overproduction of ChrF with an C-terminal hexahistidine tag This study
pchrC pJQ200SK derivative carrying the upstream and downstream regions of chrC gene This study
Primers   
NdechrCf ATACATATGTCCTTCGACATTAAACCGC This study
SalchrCr TCCGTCGACTGAGAGTCCTCCTGAGGGTTG This study
NdechrFf CGACATATGAAATGGATTACCCGCGAAC This study
SalchrFr CGAGTCGACCATCTTCGGCGGCCAGTTATG This study
chrCupf GCTGGATCCTCTGGCTTGCTGCGGGTTGCC This study
chrCupr GCTCTGCAGTCACAAGATCAAGGTCTTCAA This study
chrCdownf GCTCTGCAGATGAAATGGATTACCCGCGAA This study
chrCdownr CGACTCGAGTCACATCTTCGGCGGCCAGTT This study
chrFupf GCTGGATCCAACGGCGTGTTGCCCGTAGGC This study
chrFupr GCTCTGCAGTCATGAGAGTCCTCCTGAGGG This study
chrF’f GCTCTGCAGCCATGACGGTGAGCTTTGCAG This study
  1. Enzyme restriction site in primer sequences is shown in bold