Skip to main content

Table 2 Primers used in this study

From: Increased toxin expression in a Clostridium difficile mfd mutant

Primer name Sequence (5’ to 3’) Used for
SW78 TCTACCACTGAAGCATTAC qPCR for tcdA
SW79 TAGGTACTGTAGGTTTATTG qPCR for tcdA
SW80 ACCATATAGCTTTGTGATAGTGAAGGAAA qPCR for tcdB
SW81 AAGAACTACATCAGGTAATTCAGATACAAA qPCR for tcdB
SW82 GGATGATATGATGAAGGTTAGAAACCT qPCR for rpoB
SW83 CCCAATCCAAGTTCTTCTAGTTTTTG qPCR for rpoB
NF408 TCTTGAATATCAAAGGTGAGCCAGTACA 16S RNA amplfication
NF409 TACAGCGTGGACTACCAGGGTATCTAAT 16S RNA amplfication
NF2234 GATCGAGCTC AATATAATGGATAGTGAGAG mfd amplication
NF2298 GATCGAGCTC AATATAATGGATAGTGAGAG mfd amplication