Skip to main content

Advertisement

Table 1 PCR primers used in this study

From: Microbiological testing of pharmaceuticals and cosmetics in Egypt

Bacterial target/Primer name Forward (F) and Reverse (R) primer Annealing temperature (tm-5 °C) Nucleo-tide positionsa Gene amplified PCR product size (bp) Ref.
Universal primer pair F: 5′AGAGTTTGATCMTGGCTCAG3′ NP 16S rRNA 1500 [27]
R: 5′TACGGYACCTTGTTACGACTT3′
(46.8 °C)
S. hominis F: 5′GTTCGATAGTGAAAGATGGCTC3′ NP 16S rRNA 833-852 [24]
R: 5′GGAAACTTCTATCTCTAGAAGG3′
(43.4 °C)
S. warneri F: 5′GGTTCAATAGTGAAAGGCGGC3′ NP 16S rRNA 833-852 [24]
R: 5′GGAAGACTCTATCTCTAGAGC3′
(41.1 °C)
S. epidermidis F: 5′TCTCTTTTAATTTCATCTTCAATTCCATAG3′ 448-477 b 174 [25]
R: 5′AAACACAATTACAGTCTGTTATCCATATC3′ 593-622
(54 °C)
B. anthracis F: 5′AATCGTAATATTAAACTGACG3′ 607-627 gyrB 244 [26]
R: 5′CCTTCATACGTGTGAATGTTG3′ 831-851
(40.5 °C)
B. cereus F: 5′ATTGGTGACACCGATCAAACA3′ 490-510 gyrB 364 [26]
R: 5′TCATACGTATGGATGTTATTC3′ 834 -854
(41 °C)
B. subtilis F:5′CAGTCAGGAAATGCGTACGTC CTT3′ NP gyrA 1027 [26]
R:5′CAAGGTAATGCTCCAGGCATTGCT3′
(57.2 °C)
S. aureus F: 5′GCGATTGATGGTGATACGGTT3′ 48-70 nucA (nuclease A) 280 [32]
R: 5′AGCCAAGCCTTGACGAACTAA AGC3′ 303-328
(55 °C)
E. coli F: 5′AAAACGGCAAGAAAAAGCAG3′ 754-773 uidA (β-D-glucuro-nidase) 147 [31]
R: 5′ACGCGTGGTTACAGTCTTGCG3′ 880-900
(50.7 °C)
S. enterica F: 5′ATCGCCACGTTCGGGCAATTC3′ NP invA (invasion protein) 275 [33]
R: 5′ACGGTTCCTTTGACGGTGCGAT3′
(55 °C)
P. aeruginosa F: 5′ATGGAAATGCTGAAATTCGGC3′ NP oprL (membrane lipoprotein) 504 [28, 29]
R: 5′CTTCTTCAGCTCGACGCGACG3′
(55 °C)
  1. aNucleotide positions: refers to the positions of the nucleotides on the target gene where the forward and reverse primers anneal
  2. bA genomic DNA fragment with unknown coding potential
  3. NP Not Provided