Skip to main content

Advertisement

Table 2 Primers used to detect HIV-1 DNA products

From: SJP-L-5, a novel small-molecule compound, inhibits HIV-1 infection by blocking viral DNA nuclear entry

Primer Sequence Position
M-F TTAGACCAGATCTGAGCCTGGGAG R-U5
M-R GGGTCTGAGGGATCTCTAGTTACCAC R-U5
P-F TGTGTGCCCGTCTGTTGTG U5-gag
P-R GAGTCCTGCGTCGAGA U5-gag
CIR-F CCCTCAGACCCTTTTAGTCAGTG U5-U3 in 2-LTR circle
CIR-R TGGTGTGTAGTTCTGCCAATCA U5-U3 in 2-LTR circle
Mito-F CCACTTTCCACACAGACATC  
Mito-R TCTGGTTAGGCTGGTGTTAG