Skip to main content

Table 1 Primers used for PCR amplification of bpsl1375 and site directed mutagenesis of bpsl1375

From: Characterization of Burkholderia pseudomallei protein BPSL1375 validates the Putative hemolytic activity of the COG3176 N-Acyltransferase family

Primer name Primer Sequence (5’-3’)
BPSL1375_F CACCATGCGAGAACTGCCGA
BPSL1375_R GCGCGGCAGCGGATCGCTCA
BPSL1375_R54K_F GAAGCGCAGCGGCTGAAGCACAGTGTGTTCGCC
BPSL1375_R54K_R GGCGAACACACTGTGCTTCAGCCGCTGCGCTTC
BPSL1375_D75E_F GGCCTCGACGTCGAGCCGTTCGACC
BPSL1375_D75E_R GGTCGAACGGCTCGACGTCGAGGCC
BPSL1375_D78E_F GACGTCGATCCGTTCGAGCCGTACTGC
BPSL1375_D78E_R GCAGTACGGCTCGAACGGATCGACGTC
BPSL1375_R99K_F TGAAGGTCGTCGGCACCTATAAGGTGCTGCCGCC
BPSL1375_R99K_R GGCGGCAGCACCTTATAGGTGCCGACGACCTTCA
BPSL1375_E132D_F CGAAGATGGTCGATGTCGGCCGCTCGT
BPSL1375_E132D_R ACGAGCGGCCGACATCGACCATCTTCG
BPSL1375_R135K_F GATGGTCGAAGTCGGCAAGTCGTGCGTGCATCGCG
BPSL1375_R135K_R CGCGATGCACGCACGACTTGCCGACTTCGACCATC