Skip to main content

Table 2 Primers used in this study

From: GeXP analyzer-based multiplex reverse-transcription PCR assay for the simultaneous detection and differentiation of eleven duck viruses

Virus Forward primer sequence (5′−3′) Reverse primer sequence (5′−3′) Amplicon size (bp) Target region
AIV-M AGGTGACACTATAGAATA CAGAAACGGATGGGAGTGC GTACGACTCACTATAGGGA TATCAAGTGCAAGATCCCAATGAT 122 M
AIV-H5 AGGTGACACTATAGAATA CTTCAGGCATCAAAATGCACA GTACGACTCACTATAGGGA TAGTTTGTTCATTTCTGAGTCGGTC 285 HA
AIV-H7 AGGTGACACTATAGAATA AATGGGGCHTTCATAGCTCC GTACGACTCACTATAGGGA TGATAGCARTCRCCTTCACAA 144 HA
AIV-H9 AGGTGACACTATAGAATA ACAACAAGTGTGACAACAGAAGA GTACGACTCACTATAGGGA TCTTCCGTGGCTCTCTCC 237 HA
DHV AGGTGACACTATAGAATA TCTTCGTTGTGAAACGGATTACC GTACGACTCACTATAGGGA TGCCTGGACAGATDTGTGCCTACT 133 5UTR
DTMUV AGGTGACACTATAGAATA ATGGACAGGGTCATCAGCGG GTACGACTCACTATAGGGA GAATRGCTCCYGCCAATGCT 176 E
EDSV AGGTGACACTATAGAATA AATCGGCAACTCAAGACATC GTACGACTCACTATAGGGA CCCATTCATAAACAGGATTC 208 Penton
DEV AGGTGACACTATAGAATA GGGAGGAGCAAACAAAGA GTACGACTCACTATAGGGA ATCGCAAATTCCATCACATA 150 UL6
NDV AGGTGACACTATAGAATA GTRGCAGCAAGRACAAGG GTACGACTCACTATAGGGA CATATCYGCATACATCAA 196 L
DuCV AGGTGACACTATAGAATA TGCKCCAAAGAGTCGACATA GTACGACTCACTATAGGGA CAAAYGCATAACGGCTCTTTCC 300 Red
MDRV AGGTGACACTATAGAATA CAGTTGAGCCGGAYGGTAATT GTACGACTCACTATAGGGA ACTCGGTTGGTGTTAGTVGCVTAGAA 219 S1
MDPV AGGTGACACTATAGAATA CTTTCAGGCTACATCTTCAA GTACGACTCACTATAGGGA AATTCTCTTTTCACCCATCC 253 VP1
Universal tag sequences Tag-F: AGGTGACACTATAGAATA Tag-R: GTACGACTCACTATAGGGA   
  1. Universal tag sequences are underlined. Bold type indicates degenerate sites
  2. Abbreviations: M A or C, R A or G, W A or T, S G or C, Y C or T, K G or T, V A, G, or C, H A, C, or T, D A, G, or T; B G, C, or T